- Rnatoolbox-help - SimTK Mailing Lists

(no subject)
by Harprabhjit Kaur 21 Apr '11

21 Apr '11

1 0

Re: R: Re: R: Re: ions
by Samuel Flores 24 Jan '11

24 Jan '11

> Before your e-mail, I have tried to equalize the order number of atoms of the target and model pdb. This may not matter. RNABuilder will try to guess the positions of any missing atoms. > I have fixed the problem for His31, but there was still some problem with Iso35. Now I try to discard this residue which is not fundamental for the animation.. > What is ISO? maybe try substituting a canonical amino acid. we don't support non-canonical residues. > I have a question...Last.2.pdb is produced from the data obtained by the fitting with last.1.pdb? sort of. If you look at trajectory.2.pdb, the first frame of that trajectory should superimpose almost perfectly on last.1.pdb. Then the dynamics will run for a while, and the last frame of trajectory.2.pdb is the same as last.2.pdb. The internal coordinates at the beginning of stage 2 are matched to last.1.pdb. So one more thing you can try is adding the following parameter: matchIdealized true this will set the bond lengths and angles to their default (idealized) values. Only the torsion angles will vary, for most residues. Not sure if this will fix your problem though. please send such questions to rnatoolbox-help Sam > > Matteo > > Il 24/01/11, Samuel Flores <samuelfloresc(a)gmail.com> ha scritto: >> >> Perhaps the problem is with the structures you started with? in last.1.pdb? >> >> >> You can delete the side chain atoms from last.1.pdb and let RNABuilder guess at their positions, which might fix the issue. >> >> I looked at the files you sent last time and they seem fine. If the above doesn't work you can send me your last.1.pdb and contacts.dat again and I'll take a look. >> >> >> Sam >> >> On Jan 24, 2011, at 9:42 AM, Matteo Maria Colombo wrote: >> >>> Hi Samuel, I was ill all the weekend...now I'm better >>> >>> The ions seem to be almost ok, but the main problem now is about the residue His31, where the atoms bond are completely crazy...I've observed that in the two PDB (model and target) there is some difference in the number order of the atoms...could it be an explanation? >>> >>> Matteo >>> >>> Il 22/01/11, Samuel Flores <samuelfloresc(a)gmail.com <samuelfloresc(a)gmail.com>> ha scritto: >>>> >>>> how did things go with the ion locations? >>>> >>>> >>>>> Hi Samuel, these are the files... >>>>> >>>>> There are two main troubles: >>>>> >>>>> 1- The ions that cannot move (and i can see only one of the two I have defined) >>>>> >>>>> 2- The contacts between the residues are not well defined. >>>>> >>>>> I have tried to follow the tutorial, but I am not super familiar with program building and sure there will something that I have made wrong... >>>>> >>>>> Thank you very much for your availability! >>>>> >>>>> Matteo >>>>> <contacts.protein-morphing_mg4.dat><catB-hex-mg.pdb><catB-cd4-mg.pdb> >>>> >>

1 0

Re: chains and rnabuilder
by Samuel Flores 08 Jan '11

08 Jan '11

On Jan 7, 2011, at 3:28 PM, Pete Kekenes-Huskey wrote: > Hi Sam, > Thanks for getting back to me. I will gladly discuss this via the > rnatoolbox-help list? Should I start a new thread? Just please send it to the list as I am doing here. > > In the meantime, could you point me to the PSB talk you mentioned? > > I've verified that I am using chain Q for my template (based on a > crystal structure) and C for my input structure, as you did in the > RNABuilder documentation. I think you mean that you used C for your model, or threaded chain. You have no chain C in your input file. > What seems to happen is that the first chain > (residues 1-9) seem to assume the template conformation, while the > remaining residues (10-12) of the second chain appear as a random > coil. > Your first problem is that all your O2' atoms are in the wrong position. Easiest thing to do is delete all these atoms, and let RNABuilder guess their positions. However your main problem is that you have a gap between residues 9 and 10. The "TER" record suggests you think of these as separate chains, and yet you are using the same chain ID for residues 1-9 and 10-12, which suggests the opposite. I am going to go with the second interpretation. The solution is the following. I pride myself in supporting your ability to read in some rather unusual and chemically improbable structures. You can leave out any atom you want and let RNABuilder guess its position, with the caveat that any atoms which are children of that atom on the multibody tree will appear in an uncontrolled position. This is no problem for side chains, but in this case you are missing a main chain atom -- the P atom of residue 10. I suggest you simply rename "H5T" of residue 10 to "P". It won't be chemically correct but it will allow you to match the input structure the way you intend. > last.1.pdb is my template and the threading.dat file essentially is > using the same sequence for as the template. > > THanks again for your help! > > pete > > > On Tue, Jan 4, 2011 at 4:22 PM, Samuel Flores <samuelfloresc(a)gmail.com> wrote: >> Hi Pete, >> Thanks for your interest in RNABuilder.Threading is one of the most popular >> applications of rnabuilder. You may be interested in reading my PSB 2011 >> paper on multiple-template homology modeling. I can provide the input files >> for that project. >> Can we use the rnatoolbox-help list for this, or is it confidential? >> thanks. >> As for your question, please make sure your chain ID's for the two chains >> are different and that they match in the rnabuilder input file vs. structure >> file. >> If this is not the issue please send me your last.n.pdb and the rnabuilder >> input file, (e.g. contacts.dat). >> Sam >> You have been contacted by a member of Simtk.org. >> >> From: Pete Kekenes-Huskey >> Email: huskeypm(a)wag.caltech.edu >> >> The e-mail was sent via the "contact" link on Simtk.org by the above member. >> It is not screened by Simtk.org or its staff. >> >> >> *** MESSAGE BEGINS *** >> >> Hi Sam >> I've been using your RNABuilder program to thread short RNA sequences. I >> have a target molecule which consists of two chains separated by a TER card. >> It appears that when the 'last.n.pdb' structure (target) is loaded, the >> first chain preserves the original coordinates, but the second chain assumes >> a random coil form and is adjoined to the first chain. Do you have any >> suggestions for forcing the second chain to preserve its original >> coordinates? >> >> I can provide input files if you email me at huskeypm(a)gmail.com >> Thanks for your help! >> >> Best, >> pete >> > > > > -- > ====================== > Peter Kekenes-Huskey, Ph.D. > Postdoctoral Researcher > UCSD Dept of Pharmacology > 4205 Urey Hall > 9500 Gilman Avenue > La Jolla, CA 92093 > ====================== > <threading.dat><last.1.pdb>

1 0

Re: Queries regarding using RNABuilder for threading RNA-ligand complex
by Samuel Flores 23 Nov '10

23 Nov '10

On Nov 23, 2010, at 12:57 AM, Wee Kiang Yeo wrote: > Hi, Dr Flores, > > I am a graduate student at the National University of Singapore. > Ermm... perhaps that's kinda far from your current location? > Ha yes, quite far. However we are still on the same planet. If you think a sufficient number of people would be interested it might be possible to put together the funding for a mini-workshop. Sometime around the time of the RNA society meeting in Japan next summer, for instance. Anyway, plenty of time to think about such things. > Yes, please post the question and answer on the mailing list. > Ok, this will be my default behavior. Please send any further questions directly to the list and I will reply on there. > Is there a preferred way to treat insertion/deletions and mutations > during threading? My current approach = Only use the Superimpose > command on the nucleotides that match exactly and no such commands for > any others. I would go ahead and use the Superimpose forces on substitution mutations as well. Based on what I see you are making a good model and are nearly finished. There is no real need for a major strategy shift. The ribosome is highly conserved across organisms as you know. However if you had insertions (e.g. an entire stem-loop that exists in the model but not in the template) then you could solve the inserted part by applying WatsonCrick interactions to form any helices, and other interactions as needed to recover any tertiary contacts. Modeling in regions of low sequence identity is an art, but a good account of how we deal with this is given in our 2010 PSB paper, "Predicting RNA structure by multiple template homology modeling." Bear in mind that RNABuilder studiously avoids thinking for you. It is not a physics-based simulation code, it is more like a molecular "erector set" which only does what you tell it to do. > > I also tried to thread the original sequence from the PDB template > structure onto the template structure. But I noticed that, despite > enforcing Superimpose for every nucleotide residue, there are some > recalcitrant ones which refuse to superimpose. The main problem, I > observed from the VMD animations, is that some RNA segments get > 'entangled' with other segments. Consequently, they are unable to > fold/superimpose correctly. To help you visualise what I mean, try > place placing your right arm over your left elbow and pull them > towards your chest. I am still rather puzzled with why this happens > since the threading should proceed from one end to the other. The same > entanglements also occur with the homologous (non-template) RNA > sequence. Ah yes. The phenomenon you are referring to is a kind of kinetic trapping, and is a recurring issue in modeling. There are multiple ways of dealing with this. 1. Turn off the sterics until the Superimpose contacts have been fully or mostly satisfied. Then turn the sterics back on at a subsequent stage. 2. Apply sterics to the entire threaded chain EXCEPT those residues where you have a tangle, e.g. where the leftmost arrow is pointing in your graphic. 3. Use the "scrubber" algorithm. The Scrubber is my standard means of resolving kinetic traps. It is a combination of simulated annealing and potential rescaling. This means that I start with a high temperature and decrease it stage by stage. At the same time, I periodically turn all forces (including sterics) on and off. In a final stage I stop cycling the forces and let the molecule converge at low temperature. It sounds complicated but really it's not hard and is the most reliable way of getting out of traps. Here is a snippet that would do this: # I imagine the model you sent was built in stage 2. So start at stage 3 so you don't have to re-fold: firstStage 3 # and end at stage 5 lastStage 5 # start at some relatively higher temperature. If need be you can try 150 or even 1000. However 10 might be enough: temperature 10 3 # then lower the temperature: temperature 1 4 # stage 5 is when you are converged or close to it: temperature 1 5 # a dutyCycle of .95 means the forces are turned off 5% of the time. dutyCycle .95 3 dutyCycle .95 4 # a dutyCycle of 1 means forces are on all the time, as they are in a more conventional simulation: dutyCycle 1 5 # this means that you want the baseInteraction as well as the steric forces to be cycled (turned on and off periodically). setForceAndStericScrubber true # This is the duration, in picoseconds, of one scrubber cycle. I don't know if this will be long enough, you might make it as much as 10 times longer. scrubberPeriod 16.0 Every system is a little different so you might need to adjust the temperature's and dutyCycle's, as well as the reportingInterval and numReportingIntervals. Let me know how you do. If need be, you can send me your contacts.dat and last.1.pdb and I can debug. But please try this on your own first and see how things go. Sam > > This is the first time I am modeling RNA structure, hence I may be > rather unfamiliar with some of above-mentioned problems. > > Regards, > Wee Kiang YEO (Mr) > > > On 22 November 2010 18:28, Samuel Flores <samuelfloresc(a)gmail.com> wrote: >> can i post your question and answer to the RNABuilder-help list, so others can benefit? >> >> On Nov 22, 2010, at 3:20 AM, Wee Kiang Yeo wrote: >> >>> Dear Dr Flores, >>> >>> Two days ago, I have used RNABuilder to thread an RNA sequence through >>> a X-ray structure of 23S RNA (obtained from PDB). This X-ray structure >>> contains a ligand in a binding pocket. The original intention of >>> threading the RNA sequence was to ascertain the nucleotide residues >>> located near the ligand. However, during threading, the template X-ray >>> structure actually translocated in 3D space, leaving the >>> previously-bound ligand behind. >>> >>> My question: Is there a way to fix the position of the RNA-ligand >>> complex template during the threading process? If so, I would >>> appreciate it if you can give me an example of how to do so. >>> >>> Thanks. >>> >>> Regards, >>> Wee Kiang YEO (Mr) >> >>

1 0

Fwd: Queries regarding using RNABuilder for threading RNA-ligand complex
by Samuel Coulbourn Flores 23 Nov '10

23 Nov '10

Begin forwarded message: > From: Samuel Flores <samuelfloresc(a)gmail.com> > Date: November 22, 2010 4:28:19 AM CST > To: Wee Kiang Yeo <weekiang(a)gmail.com> > Subject: Re: Queries regarding using RNABuilder for threading RNA-ligand complex > > Absolutely! > > for example, let's say the template is strand "A". Then: > > constrainToGround A 15 > > fixes the position of the C3* atom of residue 15 of chain A to ground. If you have rigidified the entire template, you can choose any residue within it .. but it's better to choose one near the geometric center. > > You might also find it useful to set the constraintTolerance parameter to something lower. By default, the above constraint is enforced within .005 in all its internal coordinates. > > Where are you studying? I run RNABuilder workshops frequently, maybe you and your department would be interested in one at some point. > > Sam > > > > On Nov 22, 2010, at 3:20 AM, Wee Kiang Yeo wrote: > >> Dear Dr Flores, >> >> Two days ago, I have used RNABuilder to thread an RNA sequence through >> a X-ray structure of 23S RNA (obtained from PDB). This X-ray structure >> contains a ligand in a binding pocket. The original intention of >> threading the RNA sequence was to ascertain the nucleotide residues >> located near the ligand. However, during threading, the template X-ray >> structure actually translocated in 3D space, leaving the >> previously-bound ligand behind. >> >> My question: Is there a way to fix the position of the RNA-ligand >> complex template during the threading process? If so, I would >> appreciate it if you can give me an example of how to do so. >> >> Thanks. >> >> Regards, >> Wee Kiang YEO (Mr) >

1 0

Re: Compiling RNABuilder
by Samuel Flores 03 Nov '10

03 Nov '10

Hi Kristian, This error message is telling you that you need to set removeRigidBodyMomentum to false: removeRigidBodyMomentum False .. sometime before you issue the constraint command. The error message is perhaps a bit deceptive. You did not explicitly set removeRigidBodyMomentum True, that is simply the default and the error message does not discriminate between those two cases. I don't recommend compiling from source, it's a bit tedious and usually I do it when the user and I are in the same room or logged into the same computer. I just put up RNABuilder 2.1 binaries for Linux a minute ago, and could do the same for Snow Leopard, if you are using those operating systems. Windows will probably have to wait until January when I go back to visit Stanford. What are you using RNABuilder for, if it's not confidential? I will be happy to provide advice. Also, I'm now based in Europe and would be happy to think about setting up a workshop if you know a few people that would participate. Sam On Nov 3, 2010, at 11:58 AM, Kristian Rother wrote: > You have been contacted by a member of Simtk.org. > > From: Kristian Rother > Email: krother(a)rubor.de > > The e-mail was sent via the "contact" link on Simtk.org by the above member. It is not screened by Simtk.org or its staff. > > > *** MESSAGE BEGINS *** > > > Dear Sam, > > I'm having trouble using the Weld constraint in RNABuilder. It says: > SimTK Exception thrown at Repel.cpp:286: > Error detected by SimTK method [Repel.cpp]: At this time it is not possible to apply a constraint AND turn on removeRigidBodyMomentum. Please remove one of the two. > > - in the input script, there is nothing else than the starting structure, the reporting interval, and the Weld constraint set. > > Then, I tried to upgrade RNABuilder by compiling the code from SVN with SimTK Version: 2.1.0. I get a compilation error: > > In file included from /usr/local/SimTK/include/SimTKcommon/basics.h:52, > from /usr/local/SimTK/include/SimTKcommon.h:40, > from /usr/local/SimTK/include/SimTKsimbody.h:70, > from /usr/local/SimTK/include/SimTKmolmodel.h:86, > from /home/krother/rnabuilder/repo/rnatoolbox/trunk/include/Repel.h:38, > from Repel.cpp:31: > /usr/local/SimTK/include/SimTKcommon/internal/String.h:296: error: explicit template specialization cannot have a storage class > /usr/local/SimTK/include/SimTKcommon/internal/String.h:301: error: explicit template specialization cannot have a storage class > > This might be related to versions - do you have any recommendation? > > Best Regards, > Kristian >

1 0

About compiling the source codes.
by Zhiyong Wang 30 Oct '10

30 Oct '10

Hi, I passed cmake step but got stuck at make. I got those information when I tried to compile source codes of rnabuilder 2.0. Anyone can help me? Thanks a lot. [ 0%] Built target COPY_LAPACK [ 20%] Building CXX object CMakeFiles/RNABuilder.dir/src/RNABuilder.o In file included from /usr/include/c++/4.4/ext/hash_map:60, from /usr/local/SimTK/include/molmodel/internal/VoxelHash.h:11, from /usr/local/SimTK/include/molmodel/internal/AtomSubsystem.h:6, from /usr/local/SimTK/include/SimTKmolmodel.h:90, from /home/wzy/packages/rnabuild/src/rnatoolbox/trunk/src/RNABuilder.cpp:34: /usr/include/c++/4.4/backward/backward_warning.h:28: warning: #warning This file includes at least one deprecated or antiquated header which may be removed without further notice at a future date. Please use a non-deprecated interface with equivalent functionality instead. For a listing of replacement headers and interfaces, consult the file backward_warning.h. To disable this warning use -Wno-deprecated. In file included from /usr/local/SimTK/include/SimTKcommon/basics.h:52, from /usr/local/SimTK/include/SimTKcommon.h:40, from /usr/local/SimTK/include/SimTKsimbody.h:70, from /usr/local/SimTK/include/SimTKmolmodel.h:86, from /home/wzy/packages/rnabuild/src/rnatoolbox/trunk/src/RNABuilder.cpp:34: /usr/local/SimTK/include/SimTKcommon/internal/String.h:296: error: explicit template specialization cannot have a storage class /usr/local/SimTK/include/SimTKcommon/internal/String.h:301: error: explicit template specialization cannot have a storage class make[2]: *** [CMakeFiles/RNABuilder.dir/src/RNABuilder.o] Error 1 make[1]: *** [CMakeFiles/RNABuilder.dir/all] Error 2 make: *** [all] Error 2 -- Wang Zhiyong TTI-C

2 1

Fwd: OPRA
by Samuel Flores 19 Oct '10

19 Oct '10

Begin forwarded message: > From: Laura Pérez-Cano <laura(a)mmb.pcb.ub.es> > Date: October 19, 2010 2:45:57 PM GMT+02:00 > To: Samuel Flores <samuelfloresc(a)gmail.com> > Subject: Re: OPRA > > No me aclaro mucho Samuel. Porque en el fichero de entrada que me das > (contacts.dat) sólo está definida la proteína... > > Yo lo que quiero hacer es una exploración aleatoria del RNA conservando > rigidos los pares de bases que interaccionan de forma canónica. No es > ésto lo que tú hicistes? Me sonaba que habías hecho ésto mismo con el > RNA bound (1HQ1 PDB) y luego habías ido calculando la RMSD y habías visto > que visitaba la forma unbound (1CQL PDB). > > On Fri, 15 Oct 2010 17:03:26 +0200, Samuel Flores <samuelfloresc(a)gmail.com> > wrote: >> Aquí está: >> >> http://molmovdb.org/temp/laura.pdb.gz >> >> Son movimientos aleatorios. Pero si quieres hacer un morph de bound a >> unbound tan solo hay que agregar al archivo de entrada (contacts.dat) los >> siguientes elementos: >> >> sequencia de la cadena unbound >> firstResidueNumber de la cadena unbound >> threading forces de la unbound a la bound, e.g. "baseInteraction A 1 >> Superimpose B 123 Superimpose Cis" >> >> Además habrá que agreagar las coordenadas de la >> la cadena unbound al archivo last.1.pdb. >> >> te mando como attachment los archivos que usé para generar la > trayectoria. > > -- > Laura Pérez-Cano, PhD student > > Life Sciences Department > Barcelona Supercomputing Center (BSC-CNS) > C/ Jordi Girona 29, 08034 Barcelona, Spain >

1 0

Re: New RNABuilder 2.0 executables
by Samuel Flores 20 Aug '10

20 Aug '10

Hi Yaqi, You will need to change a few things to follow the POPS conventions: 1. the single-letter residue name should be in column 20, whereas RNABuilder has that in column 18. Just move the whole column over by two spaces without changing any of the other columns. This can be done with a global search-replace, or in some other way depending on your text editor. 2. You should use single-quotes rather than asterisks in atom names. For example, C1' is ok, C1* is not. This can be fixed with a global search-replace. 3. A different error occurs if any atoms are too close together. This can be fixed probably by using setting "addAllHeavyAtomSterics TRUE" and running for a short time. This will put steric spheres on all atoms except hydrogen. It's expensive, but you may only need to run for a short time. The RNABuilder input file conventions have changed. You should take a look at the RNABuilder 2.0 tutorial, which is available on the Downloads page. If you have any trouble you can send me the new contacts.dat file and I can help you update it so it runs with RNABuilder 2.0. Sam On Aug 19, 2010, at 11:56 PM, Yaqi Wan wrote: > Hi Sam, > > How is going! > I am finally working on the manuscript of Bangia group I ribozyme now and > have all ready got most of the pieces. I hope I can send it to you guys > first and then to Biochemistry by October. So I will start to bother you > again and ask you questions about RNABuilder~. > The first thing I am going to do is try your new RNABuilder and see if it > can improve my model, since some part of it does not have perfect helices. > The other thing I want to try is to generate solvent accessibility data from > the Bangia ribozyme model and compare this ideal data with my experimental > one. But I met some problems with that, the web server doesn't recognize the > .pdb file of my model. I guess it is because the residue/atom naming is > different in RNABuilder and the pdb format? Do you know how to match them or > change the output of RNABuilder? > The web server is http://mathbio.nimr.mrc.ac.uk/wiki/POPS > And the paper introducing it is http://www.ncbi.nlm.nih.gov/pubmed/12824328 > > Thanks a lot~!! > Yaqi > > > > > -----Original Message----- > From: Samuel Coulbourn Flores [mailto:samuelfloresc@gmail.com] > Sent: Monday, July 26, 2010 4:03 PM > To: Erich Chapman; Boris Fuertig; jennifer.boots(a)univie.ac.at; Bob > Zimmermann; thomas.gstrein(a)univie.ac.at; andreas.liebeg(a)univie.ac.at; > nora.sachsenmaier(a)univie.ac.at; georgeta.zemora(a)univie.ac.at; Christina > Waldisch; Francois Major; p.dallaire(a)sympatico.ca; > p.jifroodian-haghighi(a)umontreal.ca; marc.frederic.blanchet(a)umontreal.ca; > nicolas.scott(a)umontreal.ca; David Mitchell; frederique.badeaux(a)umontreal.ca; > Rick Russell; Yaqi Wan; isabelle.filiatreault(a)umontreal.ca > Subject: New RNABuilder 2.0 executables > > Hi Guys, > > I just finished an RNABuilder 2.0 binary distribution for Windows, Snow > Leopard, Leopard, and CentOS. There is also an accompanying tutorial. The > 2.0 release contains lots of new features including control blocks, springs > between atoms and from atoms to ground, potential rescaling / simulated > annealing support, and much more. In particular, the base-wise force field > now enforces the distance between corresponding C1' atoms for much improved > speed and fidelity. > > Please download from here if interested: > > https://simtk.org/project/xml/downloads.xml?group_id=359 > > Let me know if I can be of help with your projects. > > Sam >

1 0

[Rnatoolbox-help] Re: RNABuilder
by Samuel Coulbourn Flores 05 Mar '10

05 Mar '10

You would need to do it by hand or write a script to help you, no such program is available from us at this time. However if you write one it would be great if you could share it with the world. With that in mind, do you mind subscribing to the rnatoolbox-help email list? Then we can keep track of these issues. Sam On Mar 4, 2010, at 2:31 PM, Raman Parkesh wrote: > HI Sam > Thanks for your help yesterday. The sequence I have is > GGGAGAGGGUUUAAUCUGUACGAAAGUACUGAUUGGAUCCGCAAGG > > with constraint as > ......((((((((((.((((....)))).))))))))))...... > > I generated the secondary structure using Vienna RNA server and I saved the file format in .ct format. I was wondering is there any utility which helps you to convert .ct format to .dat format? > > or you have to manually modify the dat file. for example in my case I will have to specify the watson crick base pairing begining for 7th base with the 43th base and continue on. Is this correct? > > Regards > Raman > > On 3 March 2010 21:00, Raman Parkesh <rparkesh(a)gmail.com> wrote: > HI > thanks my number is > regards > Raman > > > On 3 March 2010 20:58, Samuel Coulbourn Flores <scflores(a)stanford.edu> wrote: > call me again .. i hung up accidentally > > also maybe you should give me your number > > sam > > On Mar 2, 2010, at 7:14 PM, Raman Parkesh wrote: > >> Dear Prof.Coulbourn >> I was trying your tutorial for RNABuilder. I am writing you to request for some information about how you can generate the following files from RNA secondary structures >> >> Base-interactionparameters. >> pseudoelectrostatic.csv and >> contacts.singlebasepair.1.dat >> >> Your help will be appreciated. >> Regards >> Raman > > >

1 1