Hi Sung-Huan,I think you just needed to increase baseInteractionScaleFactor. The base pairing forces were not strong enough to overcome the backbone repulsion. I have appended a command file that works (see below your last message below).I am again cc'ing the help list.SamuelI just put includeAllNonBondAtomsInResidues in global and open electronic and vdw force.Dear Samuel Flores,I try to set includeAllNonBondAtomsInResidues in my command. But I got a structure like a ring
# Sam's solution:#sequenceRNA A 1 CAAAAGUCUGGGCUAAGCCCACUGAUGAGCCGCUGAAAUGCGGCGAAACUUUUG# stagesfirstStage 1lastStage 4#general simulation parametersbaseInteractionScaleFactor 2000reportingInterval .04readFromStage 2reportingInterval .4numReportingIntervals 200readBlockEndtemperature 20randomizeInitialVelocities TRUE#base pairing forces to generate the hairpinbaseInteraction A 1 WatsonCrick A 54 WatsonCrick CisbaseInteraction A 2 WatsonCrick A 53 WatsonCrick CisbaseInteraction A 3 WatsonCrick A 52 WatsonCrick CisbaseInteraction A 4 WatsonCrick A 51 WatsonCrick CisbaseInteraction A 5 WatsonCrick A 50 WatsonCrick CisbaseInteraction A 6 WatsonCrick A 49 WatsonCrick CisbaseInteraction A 7 WatsonCrick A 48 WatsonCrick CisbaseInteraction A 9 WatsonCrick A 21 WatsonCrick CisbaseInteraction A 10 WatsonCrick A 20 WatsonCrick CisbaseInteraction A 11 WatsonCrick A 19 WatsonCrick CisbaseInteraction A 12 WatsonCrick A 18 WatsonCrick CisbaseInteraction A 13 WatsonCrick A 17 WatsonCrick CisbaseInteraction A 29 WatsonCrick A 44 WatsonCrick CisbaseInteraction A 30 WatsonCrick A 43 WatsonCrick CisbaseInteraction A 31 WatsonCrick A 42 WatsonCrick CisbaseInteraction A 32 WatsonCrick A 41 WatsonCrick CissetDefaultMDParameters2013/10/4 Sung-Huan Yu <sunghuanyu@gmail.com>Ha, I am stupid. includeAll"NonBond"AtomsInResidues. Sorry to bother you.2013/10/4 Sung-Huan Yu <sunghuanyu@gmail.com>
sorry, I would like to make sure one thing. Are the range of the command "includeAllNonBondAtomsInResidues" the helix part or loop part?
2013/10/4 Sung-Huan Yu <sunghuanyu@gmail.com>Now, I am a PhD student in IMIB of university of Wuerzburg.Dear Samuel Flores,Thank you for your reply. the following is my command. Actually, I try to use the software only two weeks. I tried "Physics where you want it" before. However, I got a structure like a big curve, the basepairing interaction can't work. Maybe I can try again.
#sequence
RNA A 1 CAAAAGUCUGGGCUAAGCCCACUGAUGAGCCGCUGAAAUGCGGCGAAACUUUUG
# stages
firstStage 1
lastStage 2
#general simulation parameters
baseInteractionScaleFactor 20
reportingInterval 4.0
temperature 20
randomizeInitialVelocities TRUE
#base pairing forces to generate the hairpin
baseInteraction A 1 WatsonCrick A 54 WatsonCrick Cis
baseInteraction A 2 WatsonCrick A 53 WatsonCrick Cis
baseInteraction A 3 WatsonCrick A 52 WatsonCrick Cis
baseInteraction A 4 WatsonCrick A 51 WatsonCrick Cis
baseInteraction A 5 WatsonCrick A 50 WatsonCrick Cis
baseInteraction A 6 WatsonCrick A 49 WatsonCrick Cis
baseInteraction A 7 WatsonCrick A 48 WatsonCrick Cis
baseInteraction A 9 WatsonCrick A 21 WatsonCrick Cis
baseInteraction A 10 WatsonCrick A 20 WatsonCrick Cis
baseInteraction A 11 WatsonCrick A 19 WatsonCrick Cis
baseInteraction A 12 WatsonCrick A 18 WatsonCrick Cis
baseInteraction A 13 WatsonCrick A 17 WatsonCrick Cis
baseInteraction A 29 WatsonCrick A 44 WatsonCrick Cis
baseInteraction A 30 WatsonCrick A 43 WatsonCrick Cis
baseInteraction A 31 WatsonCrick A 42 WatsonCrick Cis
baseInteraction A 32 WatsonCrick A 41 WatsonCrick Cis
readAtStage 1
numReportingIntervals 70
readBlockEnd
# During stage 2, do a de-tangling and de-clashing run.
# Remember, there is a stochastic element .. you may need to run this more than once to get convergence.
readAtStage 2
# All forces (including base pairing and collision-detecting sphere forces) are inactive for scrubberPeriod*(dutyCycle-1) picoseconds, and active for scrubberPeriod*dutyCycle picoseconds. Note that dutyCy
cle defaults to 1.0:
dutyCycle 1.0
scrubberPeriod 70
constraint A 1 Weld A 54
constraint A 2 Weld A 53
constraint A 3 Weld A 52
constraint A 4 Weld A 51
constraint A 5 Weld A 50
constraint A 6 Weld A 49
constraint A 7 Weld A 48
constraint A 9 Weld A 21
constraint A 10 Weld A 20
constraint A 11 Weld A 19
constraint A 12 Weld A 18
constraint A 13 Weld A 17
constraint A 29 Weld A 44
constraint A 30 Weld A 43
constraint A 31 Weld A 42
constraint A 32 Weld A 41
constraintTolerance .001
numReportingIntervals 280
# add collision-detecting steric spheres to all atoms except hydrogen. Note that the radius and stiffness of these spheres is set with the excludedVolumeRadius and excludedVolumeStiffness parameters:
contact AllHeavyAtomSterics A
# a higher temperature is good for thermal exploration
temperature 30
readBlockEnd2013/10/4 Samuel Flores <samuelfloresc@gmail.com>Hi Sung-Huan
I'm cc'ing the help list since there's nothing particularly private here -- let me know if you prefer not to.
"Physics where you want it" is now much faster. I much prefer to use than now, rather than the "contact" commands. The command you want is probably "includeAllNonBondAtomsInResidues." You'll find it in the reference guide.
You can also send me your command file if you want me to take a quick look.
What university do you work at, out of curiosity?
Sam
On Oct 4, 2013, at 5:37 PM, Sung-Huan Yu <noreply@simtk.org> wrote:
> You have been contacted by a member of Simtk.org.
>
> From: Sung-Huan Yu
> Email: sunghuanyu@gmail.com
>
> The e-mail was sent via the "contact" link on Simtk.org by the above member. It is not screened by Simtk.org or its staff.
>
>
> *** MESSAGE BEGINS ***
>
> Hi,
>
> Recently, I try to simulate RNA 3d structure from sequence. However, I usually get the results of strand crossing. I mean the one strand pierce through another strand ( it is very clear to see in New cartoon presentation). Therefore, they will aggregate together. Could you give me some suggestions to set some parameters to avoid this situation? I already try some parameters about atom steric. it will make the basepairings become wrong. I also tried some numbers of the baseInteractionScaleFactor. it still not works. Thank you