You would need to do it by hand or write a script to help you, no such program is available from us at this time.  However if you write one it would be great if you could share it with the world.  With that in mind, do you mind subscribing to the rnatoolbox-help email list?  Then we can keep track of these issues.

Sam

On Mar 4, 2010, at 2:31 PM, Raman Parkesh wrote:

HI Sam

Thanks for your help yesterday. The sequence I have is

GGGAGAGGGUUUAAUCUGUACGAAAGUACUGAUUGGAUCCGCAAGG

with constraint as

......((((((((((.((((....)))).))))))))))......

 

I generated the secondary structure using Vienna RNA server and I saved the file format in .ct format. I was wondering is there any utility which helps you to convert .ct format to .dat format?

or you have to manually modify the dat file. for example in my case I will have to specify the watson crick base pairing begining for 7th base with the 43th base and continue on.  Is this correct?

Regards

Raman

On 3 March 2010 21:00, Raman Parkesh <rparkesh@gmail.com> wrote:

HI 

thanks my number is

regards

Raman

On 3 March 2010 20:58, Samuel Coulbourn Flores <scflores@stanford.edu> wrote:

call me again .. i hung up accidentally

also maybe you should give me your number

sam

On Mar 2, 2010, at 7:14 PM, Raman Parkesh wrote:

Dear Prof.Coulbourn

I was trying your tutorial for RNABuilder. I am writing you to request for some information about how you can generate  the following files from RNA secondary structures

Base-interactionparameters.

pseudoelectrostatic.csv and

contacts.singlebasepair.1.dat

Your help will be appreciated.

Regards

Raman