[Rnatoolbox-help] Re: RNABuilder

[Samuel Coulbourn Flores]

You can subscribe to the list here:

https://simtk.org/mailman/listinfo/rnatoolbox-help



On Mar 4, 2010, at 4:07 PM, Samuel Coulbourn Flores wrote:

> You would need to do it by hand or write a script to help you, no such program is available from us at this time.  However if you write one it would be great if you could share it with the world.  With that in mind, do you mind subscribing to the rnatoolbox-help email list?  Then we can keep track of these issues.
> 
> Sam
> 
> 
> On Mar 4, 2010, at 2:31 PM, Raman Parkesh wrote:
> 
>> HI Sam
>> Thanks for your help yesterday. The sequence I have is
>> GGGAGAGGGUUUAAUCUGUACGAAAGUACUGAUUGGAUCCGCAAGG
>> 
>> with constraint as
>> ......((((((((((.((((....)))).))))))))))......
>>  
>> I generated the secondary structure using Vienna RNA server and I saved the file format in .ct format. I was wondering is there any utility which helps you to convert .ct format to .dat format?
>> 
>> or you have to manually modify the dat file. for example in my case I will have to specify the watson crick base pairing begining for 7th base with the 43th base and continue on.  Is this correct?
>> 
>> Regards
>> Raman
>> 
>> On 3 March 2010 21:00, Raman Parkesh <rparkesh at gmail.com> wrote:
>> HI 
>> thanks my number is
>> regards
>> Raman
>> 
>> 
>> On 3 March 2010 20:58, Samuel Coulbourn Flores <scflores at stanford.edu> wrote:
>> call me again .. i hung up accidentally
>> 
>> also maybe you should give me your number
>> 
>> sam
>> 
>> On Mar 2, 2010, at 7:14 PM, Raman Parkesh wrote:
>> 
>>> Dear Prof.Coulbourn
>>> I was trying your tutorial for RNABuilder. I am writing you to request for some information about how you can generate  the following files from RNA secondary structures
>>> 
>>> Base-interactionparameters.
>>> pseudoelectrostatic.csv and
>>> contacts.singlebasepair.1.dat
>>> 
>>> Your help will be appreciated.
>>> Regards
>>> Raman
>> 
>> 
>> 
> 

-------------- next part --------------
An HTML attachment was scrubbed...
URL: https://simtk.org/pipermail/rnatoolbox-help/attachments/20100304/34df6924/attachment.html