[RNABuilder-help] Re: About the cross the strand of RNA

Sat Oct 5 06:20:35 PDT 2013

Hi Sung-Huan,

I think you just needed to increase baseInteractionScaleFactor.  The base pairing forces were not strong enough to overcome the backbone repulsion.  I have appended a command file that works (see below your last message below).

I am again cc'ing the help list.

Samuel

> Dear Samuel Flores,
> 
> I try to set includeAllNonBondAtomsInResidues in my command. But I got a structure like a ring
> 
> I just put includeAllNonBondAtomsInResidues in global and open electronic and vdw force.
> 

# Sam's solution:

#sequence
RNA A 1    CAAAAGUCUGGGCUAAGCCCACUGAUGAGCCGCUGAAAUGCGGCGAAACUUUUG

# stages
firstStage 3
lastStage 4

#general simulation parameters
baseInteractionScaleFactor     2000
reportingInterval .04
readFromStage 3
reportingInterval .4
numReportingIntervals 200
readBlockEnd
temperature 20 
randomizeInitialVelocities TRUE
#base pairing forces to generate the hairpin 
baseInteraction A 1 WatsonCrick A 54 WatsonCrick Cis 
baseInteraction A 2 WatsonCrick A 53 WatsonCrick Cis 
baseInteraction A 3 WatsonCrick A 52 WatsonCrick Cis
baseInteraction A 4 WatsonCrick A 51 WatsonCrick Cis
baseInteraction A 5 WatsonCrick A 50 WatsonCrick Cis
baseInteraction A 6 WatsonCrick A 49 WatsonCrick Cis
baseInteraction A 7 WatsonCrick A 48 WatsonCrick Cis
baseInteraction A 9 WatsonCrick A 21 WatsonCrick Cis
baseInteraction A 10 WatsonCrick A 20 WatsonCrick Cis
baseInteraction A 11 WatsonCrick A 19 WatsonCrick Cis
baseInteraction A 12 WatsonCrick A 18 WatsonCrick Cis
baseInteraction A 13 WatsonCrick A 17 WatsonCrick Cis
baseInteraction A 29 WatsonCrick A 44 WatsonCrick Cis
baseInteraction A 30 WatsonCrick A 43 WatsonCrick Cis
baseInteraction A 31 WatsonCrick A 42 WatsonCrick Cis
baseInteraction A 32 WatsonCrick A 41 WatsonCrick Cis

setDefaultMDParameters

> 
> 2013/10/4 Sung-Huan Yu <sunghuanyu at gmail.com>
> Ha, I am stupid. includeAll"NonBond"AtomsInResidues. Sorry to bother you.
> 
> 
> 2013/10/4 Sung-Huan Yu <sunghuanyu at gmail.com>
> sorry, I would like to make sure one thing. Are the range of the command "includeAllNonBondAtomsInResidues" the helix part or loop part?
> 
> 
> 2013/10/4 Sung-Huan Yu <sunghuanyu at gmail.com>
> Dear Samuel Flores,
> 
> Thank you for your reply. the following is my command. Actually, I try to use the software only two weeks. I tried "Physics where you want it" before. However, I got a structure like a big curve, the basepairing interaction can't work. Maybe I can try again.
> 
> Now, I am a PhD student in IMIB of university of Wuerzburg. 
> 
> #sequence
> RNA A 1    CAAAAGUCUGGGCUAAGCCCACUGAUGAGCCGCUGAAAUGCGGCGAAACUUUUG
> 
> # stages
> firstStage 1
> lastStage 2
> 
> #general simulation parameters
> baseInteractionScaleFactor     20
> reportingInterval 4.0
> temperature 20 
> randomizeInitialVelocities TRUE
> #base pairing forces to generate the hairpin 
> baseInteraction A 1 WatsonCrick A 54 WatsonCrick Cis 
> baseInteraction A 2 WatsonCrick A 53 WatsonCrick Cis 
> baseInteraction A 3 WatsonCrick A 52 WatsonCrick Cis
> baseInteraction A 4 WatsonCrick A 51 WatsonCrick Cis
> baseInteraction A 5 WatsonCrick A 50 WatsonCrick Cis
> baseInteraction A 6 WatsonCrick A 49 WatsonCrick Cis
> baseInteraction A 7 WatsonCrick A 48 WatsonCrick Cis
> baseInteraction A 9 WatsonCrick A 21 WatsonCrick Cis
> baseInteraction A 10 WatsonCrick A 20 WatsonCrick Cis
> baseInteraction A 11 WatsonCrick A 19 WatsonCrick Cis
> baseInteraction A 12 WatsonCrick A 18 WatsonCrick Cis
> baseInteraction A 13 WatsonCrick A 17 WatsonCrick Cis
> baseInteraction A 29 WatsonCrick A 44 WatsonCrick Cis
> baseInteraction A 30 WatsonCrick A 43 WatsonCrick Cis
> baseInteraction A 31 WatsonCrick A 42 WatsonCrick Cis
> baseInteraction A 32 WatsonCrick A 41 WatsonCrick Cis
> 
> readAtStage 1
> numReportingIntervals 70
> readBlockEnd
> 
> # During stage 2, do a de-tangling and de-clashing run.
> # Remember, there is a stochastic element .. you may need to run this more than once to get convergence.
> readAtStage 2
> # All forces (including base pairing and collision-detecting sphere forces) are inactive for scrubberPeriod*(dutyCycle-1) picoseconds, and active for scrubberPeriod*dutyCycle picoseconds.  Note that dutyCy
> cle defaults to 1.0:
> dutyCycle 1.0
> scrubberPeriod 70
> constraint      A 1 Weld  A 54
> constraint      A 2 Weld  A 53
> constraint      A 3 Weld  A 52
> constraint      A 4 Weld  A 51
> constraint      A 5 Weld  A 50
> constraint      A 6 Weld  A 49
> constraint      A 7 Weld  A 48
> constraint      A 9 Weld  A 21
> constraint      A 10 Weld  A 20
> constraint      A 11 Weld  A 19
> constraint      A 12 Weld  A 18
> constraint      A 13 Weld  A 17
> constraint      A 29 Weld  A 44
> constraint      A 30 Weld  A 43
> constraint      A 31 Weld  A 42
> constraint      A 32 Weld  A 41
> constraintTolerance .001
> 
> numReportingIntervals 280
> # add collision-detecting steric spheres to all atoms except hydrogen.  Note that the radius and stiffness of these spheres is set with the excludedVolumeRadius and excludedVolumeStiffness parameters:
> contact AllHeavyAtomSterics A
> # a higher temperature is good for thermal exploration
> temperature  30  
> readBlockEnd
> 
> 
> 
> 2013/10/4 Samuel Flores <samuelfloresc at gmail.com>
> Hi Sung-Huan
> 
> I'm cc'ing the help list since there's nothing particularly private here -- let me know if you prefer not to.
> 
> "Physics where you want it" is now much faster.  I much prefer to use than now, rather than the "contact" commands.  The command you want is probably "includeAllNonBondAtomsInResidues."  You'll find it in the reference guide.
> 
> You can also send me your command file if you want me to take a quick look.
> 
> What university do you work at, out of curiosity?
> 
> Sam
> 
> 
> 
> 
> On Oct 4, 2013, at 5:37 PM, Sung-Huan Yu <noreply at simtk.org> wrote:
> 
> > You have been contacted by a member of Simtk.org.
> >
> > From: Sung-Huan Yu
> > Email: sunghuanyu at gmail.com
> >
> > The e-mail was sent via the "contact" link on Simtk.org by the above member. It is not screened by Simtk.org or its staff.
> >
> >
> > *** MESSAGE BEGINS ***
> >
> > Hi,
> >
> > Recently, I try to simulate RNA 3d structure from sequence. However, I usually get the results of strand crossing. I mean the one strand pierce through another strand ( it is very clear to see in New cartoon presentation). Therefore, they will aggregate together. Could you give me some suggestions to set some parameters to avoid this situation? I already try some parameters about atom steric. it will make the basepairings become wrong. I also tried some numbers of the baseInteractionScaleFactor. it still not works. Thank you
> 
> 
> 
> 
> 

-------------- next part --------------
An HTML attachment was scrubbed...
URL: https://simtk.org/pipermail/rnatoolbox-help/attachments/20131005/7ee94416/attachment.html