[RNABuilder-help] Re: About the cross the strand of RNA

Samuel Flores samuelfloresc at gmail.com
Sat Oct 5 06:25:20 PDT 2013


Slight correction .. start at stage 1.  You could probably make this run a little faster and not use more than one stage .. but I'll let you work on that.

It's a good thing you bring this up.  This is actually a lot easier to do now that the MD force field can be evaluated so much faster.  I think you said you're on 2.13?  If not, be sure to upgrade.  

Example 1 in the tutorial has been updated to converge better, for release 2.14 which is not out yet.  I can provide the updated example upon request.

Sam

 
> 
> Hi Sung-Huan,
> 
> I think you just needed to increase baseInteractionScaleFactor.  The base pairing forces were not strong enough to overcome the backbone repulsion.  I have appended a command file that works (see below your last message below).
> 
> I am again cc'ing the help list.
> 
> Samuel
> 
>> Dear Samuel Flores,
>> 
>> I try to set includeAllNonBondAtomsInResidues in my command. But I got a structure like a ring
>> 
>> I just put includeAllNonBondAtomsInResidues in global and open electronic and vdw force.
>> 
> 
> 
> # Sam's solution:
> 
> #sequence
> RNA A 1    CAAAAGUCUGGGCUAAGCCCACUGAUGAGCCGCUGAAAUGCGGCGAAACUUUUG
> 
> # stages
> firstStage 1
> lastStage 4
> 
> #general simulation parameters
> baseInteractionScaleFactor     2000
> reportingInterval .04
> readFromStage 2
> reportingInterval .4
> numReportingIntervals 200
> readBlockEnd
> temperature 20 
> randomizeInitialVelocities TRUE
> #base pairing forces to generate the hairpin 
> baseInteraction A 1 WatsonCrick A 54 WatsonCrick Cis 
> baseInteraction A 2 WatsonCrick A 53 WatsonCrick Cis 
> baseInteraction A 3 WatsonCrick A 52 WatsonCrick Cis
> baseInteraction A 4 WatsonCrick A 51 WatsonCrick Cis
> baseInteraction A 5 WatsonCrick A 50 WatsonCrick Cis
> baseInteraction A 6 WatsonCrick A 49 WatsonCrick Cis
> baseInteraction A 7 WatsonCrick A 48 WatsonCrick Cis
> baseInteraction A 9 WatsonCrick A 21 WatsonCrick Cis
> baseInteraction A 10 WatsonCrick A 20 WatsonCrick Cis
> baseInteraction A 11 WatsonCrick A 19 WatsonCrick Cis
> baseInteraction A 12 WatsonCrick A 18 WatsonCrick Cis
> baseInteraction A 13 WatsonCrick A 17 WatsonCrick Cis
> baseInteraction A 29 WatsonCrick A 44 WatsonCrick Cis
> baseInteraction A 30 WatsonCrick A 43 WatsonCrick Cis
> baseInteraction A 31 WatsonCrick A 42 WatsonCrick Cis
> baseInteraction A 32 WatsonCrick A 41 WatsonCrick Cis
> 
> setDefaultMDParameters
> 
> 
> 
>> 
>> 2013/10/4 Sung-Huan Yu <sunghuanyu at gmail.com>
>> Ha, I am stupid. includeAll"NonBond"AtomsInResidues. Sorry to bother you.
>> 
>> 
>> 2013/10/4 Sung-Huan Yu <sunghuanyu at gmail.com>
>> sorry, I would like to make sure one thing. Are the range of the command "includeAllNonBondAtomsInResidues" the helix part or loop part?
>> 
>> 
>> 2013/10/4 Sung-Huan Yu <sunghuanyu at gmail.com>
>> Dear Samuel Flores,
>> 
>> Thank you for your reply. the following is my command. Actually, I try to use the software only two weeks. I tried "Physics where you want it" before. However, I got a structure like a big curve, the basepairing interaction can't work. Maybe I can try again.
>> 
>> Now, I am a PhD student in IMIB of university of Wuerzburg. 
>> 
>> #sequence
>> RNA A 1    CAAAAGUCUGGGCUAAGCCCACUGAUGAGCCGCUGAAAUGCGGCGAAACUUUUG
>> 
>> # stages
>> firstStage 1
>> lastStage 2
>> 
>> #general simulation parameters
>> baseInteractionScaleFactor     20
>> reportingInterval 4.0
>> temperature 20 
>> randomizeInitialVelocities TRUE
>> #base pairing forces to generate the hairpin 
>> baseInteraction A 1 WatsonCrick A 54 WatsonCrick Cis 
>> baseInteraction A 2 WatsonCrick A 53 WatsonCrick Cis 
>> baseInteraction A 3 WatsonCrick A 52 WatsonCrick Cis
>> baseInteraction A 4 WatsonCrick A 51 WatsonCrick Cis
>> baseInteraction A 5 WatsonCrick A 50 WatsonCrick Cis
>> baseInteraction A 6 WatsonCrick A 49 WatsonCrick Cis
>> baseInteraction A 7 WatsonCrick A 48 WatsonCrick Cis
>> baseInteraction A 9 WatsonCrick A 21 WatsonCrick Cis
>> baseInteraction A 10 WatsonCrick A 20 WatsonCrick Cis
>> baseInteraction A 11 WatsonCrick A 19 WatsonCrick Cis
>> baseInteraction A 12 WatsonCrick A 18 WatsonCrick Cis
>> baseInteraction A 13 WatsonCrick A 17 WatsonCrick Cis
>> baseInteraction A 29 WatsonCrick A 44 WatsonCrick Cis
>> baseInteraction A 30 WatsonCrick A 43 WatsonCrick Cis
>> baseInteraction A 31 WatsonCrick A 42 WatsonCrick Cis
>> baseInteraction A 32 WatsonCrick A 41 WatsonCrick Cis
>> 
>> readAtStage 1
>> numReportingIntervals 70
>> readBlockEnd
>> 
>> # During stage 2, do a de-tangling and de-clashing run.
>> # Remember, there is a stochastic element .. you may need to run this more than once to get convergence.
>> readAtStage 2
>> # All forces (including base pairing and collision-detecting sphere forces) are inactive for scrubberPeriod*(dutyCycle-1) picoseconds, and active for scrubberPeriod*dutyCycle picoseconds.  Note that dutyCy
>> cle defaults to 1.0:
>> dutyCycle 1.0
>> scrubberPeriod 70
>> constraint      A 1 Weld  A 54
>> constraint      A 2 Weld  A 53
>> constraint      A 3 Weld  A 52
>> constraint      A 4 Weld  A 51
>> constraint      A 5 Weld  A 50
>> constraint      A 6 Weld  A 49
>> constraint      A 7 Weld  A 48
>> constraint      A 9 Weld  A 21
>> constraint      A 10 Weld  A 20
>> constraint      A 11 Weld  A 19
>> constraint      A 12 Weld  A 18
>> constraint      A 13 Weld  A 17
>> constraint      A 29 Weld  A 44
>> constraint      A 30 Weld  A 43
>> constraint      A 31 Weld  A 42
>> constraint      A 32 Weld  A 41
>> constraintTolerance .001
>> 
>> numReportingIntervals 280
>> # add collision-detecting steric spheres to all atoms except hydrogen.  Note that the radius and stiffness of these spheres is set with the excludedVolumeRadius and excludedVolumeStiffness parameters:
>> contact AllHeavyAtomSterics A
>> # a higher temperature is good for thermal exploration
>> temperature  30  
>> readBlockEnd
>> 
>> 
>> 
>> 2013/10/4 Samuel Flores <samuelfloresc at gmail.com>
>> Hi Sung-Huan
>> 
>> I'm cc'ing the help list since there's nothing particularly private here -- let me know if you prefer not to.
>> 
>> "Physics where you want it" is now much faster.  I much prefer to use than now, rather than the "contact" commands.  The command you want is probably "includeAllNonBondAtomsInResidues."  You'll find it in the reference guide.
>> 
>> You can also send me your command file if you want me to take a quick look.
>> 
>> What university do you work at, out of curiosity?
>> 
>> Sam
>> 
>> 
>> 
>> 
>> On Oct 4, 2013, at 5:37 PM, Sung-Huan Yu <noreply at simtk.org> wrote:
>> 
>> > You have been contacted by a member of Simtk.org.
>> >
>> > From: Sung-Huan Yu
>> > Email: sunghuanyu at gmail.com
>> >
>> > The e-mail was sent via the "contact" link on Simtk.org by the above member. It is not screened by Simtk.org or its staff.
>> >
>> >
>> > *** MESSAGE BEGINS ***
>> >
>> > Hi,
>> >
>> > Recently, I try to simulate RNA 3d structure from sequence. However, I usually get the results of strand crossing. I mean the one strand pierce through another strand ( it is very clear to see in New cartoon presentation). Therefore, they will aggregate together. Could you give me some suggestions to set some parameters to avoid this situation? I already try some parameters about atom steric. it will make the basepairings become wrong. I also tried some numbers of the baseInteractionScaleFactor. it still not works. Thank you
>> 
>> 
>> 
>> 
>> 
> 

-------------- next part --------------
An HTML attachment was scrubbed...
URL: https://simtk.org/pipermail/rnatoolbox-help/attachments/20131005/bf8a3f6d/attachment-0001.html


More information about the Rnatoolbox-help mailing list